24KJose 24KJose
  • 04-05-2016
  • Mathematics
contestada

Please help. Due soon.

Please help Due soon class=

Respuesta :

austinmcdowell austinmcdowell
  • 04-05-2016
The function represents exponential growth (since the exponent is positive).

The percentage increase is, if I'm not mistaken, 181.3% (since 710 is just a constant, we don't need to worry about that - it won't affect the growth rate of the function)
Answer Link

Otras preguntas

Why were the committees of correspondence powerful?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Susan ........ (Run) to school because she was late.
who was the founder of Pennsylvania?
What Role Does the Sun Play in Producing Winds And Ocean Currents
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5