john3747 john3747

02-09-2016
Biology

contestada

Which organelle sends out microtubules that connect to DNA during Metaphase?

Respuesta :

TheEmoRose1723 TheEmoRose1723

21-04-2022

Answer:

Centrioles

Explanation:

Centrioles are located in the near the center of the cell and helps out with sending DNA.

Answer Link

Otras preguntas

A fitness contract is a/an A. evaluation of strength, flexibility, endurance, and proper nutrition. B. written document stating an individual's

Which of the following excerpts from Fast Food Nation best provides evidence that fast food restaurants are designed for using unskilled labor? Her family’s mo

Which section of an article would you look at to find out if assessors were blinded to treatment assignment?

Which two states were admitted to the united states as part of the missouri compromise?

(60) Points HeLp asap 5 questions

Differences between body composition- risk for heart disease or chronic disease.

Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

who invented the glass harmonica

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou