angel71650
angel71650 angel71650
  • 02-10-2020
  • Mathematics
contestada

Which number(s) on the number line could be described as an integer, but not a natural number​

Which numbers on the number line could be described as an integer but not a natural number class=

Respuesta :

rustyrumi rustyrumi
  • 02-10-2020

Answer:

-6

Step-by-step explanation:

Natural numbers are any whole number that is 0+. So, we 100% know that -6 is an integer, as natural numbers are only positive.

Answer Link

Otras preguntas

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
What would be the most likely effect of one company buying a competitor?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
solve the simultaneous equation 4x+7y=1 3x+10y=15
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
What is the range of function of y-1=(x+3)^2
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front