arzunaima arzunaima
  • 04-10-2021
  • English
contestada

6. Who went shopping O dependent O independent.
​

Respuesta :

faylilly
faylilly faylilly
  • 05-10-2021

Answer:

this is a dependent clause because it has one verb

Explanation:

Answer Link

Otras preguntas

What are the types of maps??
Simplify (2-4i)(-1+5i)
which was one contributing factor to the growth of medieval
Which of the following groups of moon phases are above the horizon at 8 pm? A. third quarter, waning crescent, and waxing gibbous B. new Moon, third quarte
In the equation 3x+4=13, the 3 is called what? *
Una empresa elabora aceites de tres calidades distintas. Del primer aceite se elaboran 640 L, del segundo 800 L, y del tercero 480 L. Si se quiere envasar el ac
y 18 NA -6 68 110 -2 4 to -6 do What’s the equation for the graph
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Mettez au futur proche : 1. Elle ________ (courir) à l’université. 2. Tu _______ (faire) tes travaux ? 3. Nous _______ (acheter) une bicyclette ? 4. Elles _____
Elaborate on what is meant by the heading "Fringe Voices Get a Platform" In regards to positive effects from the Improvement of the printing press.