sierosenthal sierosenthal
  • 03-01-2022
  • Mathematics
contestada

Multiply x2-3x-2 by 1/7x.

Respuesta :

myajaycee myajaycee
  • 03-01-2022
So, the problem is 2x - 3x - 2 • 1/7x ?

2x - 3x - 2 • 1/7x

So, combine like terms.

-1x - 2 • 1/7x

-1/7x • 2

The answer would be about -0.3x ?

If I’m understanding correctly.
Answer Link

Otras preguntas

what is the meaning of tallow​
When I first moved to China, it took me a long time to ____ the language. • Get used to speak • Get used speaking • Get used to speaking • Be used to speaking
If a club consists of 11 members, how many different arrangements of president, vice-president, and secretary are possible?
PLEASE HELP I WILL MARK BRAINLIEST
w 2. Who helps Aschenputtel pick up the lentils out of the ashes? a. birds b. squirrels c. mice d. rabbits
D(1) =3 D(n) = d(n-1)-14
equations F= -kx F= m x a or F= m x g g= -9.8 m/s2 When a 0.50 kg-object is attached to a vertically supported spring, it stretches 0.10 m from the equilibrium
Why do you think the Patriots described this incident as the "Boston Massacre" even though only 5 people were actually killed?
2. What was the outcome of the charge? Was anything accomplished? Explain your answer.
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA