williambaca
williambaca williambaca
  • 03-01-2022
  • Mathematics
contestada

What is the value of −(3)4?

Respuesta :

amelia2468
amelia2468 amelia2468
  • 03-01-2022

Answer:

not totally sure but is it -12?

Step-by-step explanation:

Answer Link

Otras preguntas

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15
the mammalian heart has: a. 4 chambers b. 2 chambers c. a two-sided muscular pump d. four-sided muscular pump e. a and c f. b and d
The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.
Everfi the person who receives financial protection from a life insurance plan is called a:
6. Which of the following is a consequence of chronic alcohol use? A. gastritis B. stomach ulcers C. heartburn D. All of the above
which combination of quarks produces a neutral baryon
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How do the structures of alveoli and capillaries support the function of gas exchange?
What was a major effect of the agricultural revolution in the united states during the late 1800's?
For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle