dc396871 dc396871
  • 02-02-2022
  • Mathematics
contestada

Will mark brainliest

Will mark brainliest class=

Respuesta :

sommie51
sommie51 sommie51
  • 02-02-2022

Step-by-step explanation:

Is this a parallelogram

Answer Link

Otras preguntas

Concerns over the Spanish treatment of what nation help lead to the Spanish–American War? A. Hawaii B. Portugal C. Canada D. Cuba
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
Find the area of a kite with diagonals 10 & 5
Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp
What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2
Alice spent 6 minutes on each factoring problem and 3 minutes on each evaluation problem. she spent a total of 42 minutes on 9 problems. how many minutes did sh
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts
which goal stated in the preamble to the u.s. constitution requires a strong army
need help anybody know how to do this